DUET 2019 MSc Botany Previous Queston Papers

Delhi University Entrance Test (DUET) 2019 MSc Botany Previous Queston Papers

Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.
9684:Uronic Acid Pathways ,
9685:tissues that synthesize sucrose ,
9686:tissues that utilize sucrose ,
9687:photosynthetic leaves ,
9688:sucrose exporting tissue ,
9689:Fructose-2, 6-bisphosphate ,
9690:Fructose-1, 6-bisphosphate ,
9691:Fructose 6-phosphate ,
9692:Fructose 2-phosphate ,
9693:DNA X has a double-stranded and
linear structure ,
9694:DNA Y has a double-stranded and
circular structure ,
9695:DNA X has a single-stranded and
linear structure ,
9696:DNA X has a single-stranded and
circular structure ,
9697: 5? ? ATGACGA ? 3? and 5? ?
GTCACGG ? 3? ,
9698: 5? ? TACTGCT ? 3? and 5? ?
GGCACTG? 3? ,
9699: 5? ? TCGTCAT ? 3? and 5? ?
CCGTGAC ? 3? ,
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
80 2423 DU_J19_
MSC_BOT
_Q79
Which one of the following is considered to be a
signal metabolite that regulates the partitioning
between sucrose and starch synthesis?
79 2422 DU_J19_
MSC_BOT
_Q78
High activity of sucrose synthase is present in
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
81 2424 DU_J19_
MSC_BOT
_Q80
Two different DNA molecules were isolated from a
bacterial sample. Further experiments
demonstrated that one of these (X) was composed
of 40%A, 40%G, 10%T and 10%C but could not
be cut by an exonuclease. The second DNA sample
(Y) could be cut by the exonuclease and was
found to be composed of 30%A, 30%T, 20%G and
20%C. Which one of the following statements can
be correctly deduced from the above?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.
9684:Uronic Acid Pathways ,
9685:tissues that synthesize sucrose ,
9686:tissues that utilize sucrose ,
9687:photosynthetic leaves ,
9688:sucrose exporting tissue ,
9689:Fructose-2, 6-bisphosphate ,
9690:Fructose-1, 6-bisphosphate ,
9691:Fructose 6-phosphate ,
9692:Fructose 2-phosphate ,
9693:DNA X has a double-stranded and
linear structure ,
9694:DNA Y has a double-stranded and
circular structure ,
9695:DNA X has a single-stranded and
linear structure ,
9696:DNA X has a single-stranded and
circular structure ,
9697: 5? ? ATGACGA ? 3? and 5? ?
GTCACGG ? 3? ,
9698: 5? ? TACTGCT ? 3? and 5? ?
GGCACTG? 3? ,
9699: 5? ? TCGTCAT ? 3? and 5? ?
CCGTGAC ? 3? ,
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
80 2423 DU_J19_
MSC_BOT
_Q79
Which one of the following is considered to be a
signal metabolite that regulates the partitioning
between sucrose and starch synthesis?
79 2422 DU_J19_
MSC_BOT
_Q78
High activity of sucrose synthase is present in
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
81 2424 DU_J19_
MSC_BOT
_Q80
Two different DNA molecules were isolated from a
bacterial sample. Further experiments
demonstrated that one of these (X) was composed
of 40%A, 40%G, 10%T and 10%C but could not
be cut by an exonuclease. The second DNA sample
(Y) could be cut by the exonuclease and was
found to be composed of 30%A, 30%T, 20%G and
20%C. Which one of the following statements can
be correctly deduced from the above?
9700: 5? ? ATGACGA ? 3? and 5? ?
CCGTGAC ? 3?,
9701:roots. ,
9702:callus. ,
9703:embryos. ,
9704:shoots. ,
9705:EPSPS? ,
9706:pat? ,
9707:ALS? ,
9708:nptII? ,
9709:They are generally composed of
larger fragments as compared to
genomic DNA libraries ,
9710:They can be used to study
alternatively spliced forms of a gene ,
9711:They can be used to study
quantitative variations in gene
expressions levels between different
tissues ,
9712:They can be used to analyse
variations in gene expression patterns
between different developmental stages
of a plant ,
9713:Maize ,
9714:Wheat ,
9715:Rice ,
9716:Barley ,
9717:genetically modified foods from
plants. ,
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
84 2427 DU_J19_
MSC_BOT
_Q83
Which one of the following genes?does not?confer
resistance to a herbicide?
83 2426 DU_J19_
MSC_BOT
_Q82
In plant tissue culture, a high cytokinin : auxin
ratio promotes the formation of
86 2429 DU_J19_
MSC_BOT
_Q85
Which one of the following crops was the first to
have its nuclear genome sequenced?
85 2428 DU_J19_
MSC_BOT
_Q84
Which one of the following statements about cDNA
libraries?is not?correct?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.
9684:Uronic Acid Pathways ,
9685:tissues that synthesize sucrose ,
9686:tissues that utilize sucrose ,
9687:photosynthetic leaves ,
9688:sucrose exporting tissue ,
9689:Fructose-2, 6-bisphosphate ,
9690:Fructose-1, 6-bisphosphate ,
9691:Fructose 6-phosphate ,
9692:Fructose 2-phosphate ,
9693:DNA X has a double-stranded and
linear structure ,
9694:DNA Y has a double-stranded and
circular structure ,
9695:DNA X has a single-stranded and
linear structure ,
9696:DNA X has a single-stranded and
circular structure ,
9697: 5? ? ATGACGA ? 3? and 5? ?
GTCACGG ? 3? ,
9698: 5? ? TACTGCT ? 3? and 5? ?
GGCACTG? 3? ,
9699: 5? ? TCGTCAT ? 3? and 5? ?
CCGTGAC ? 3? ,
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
80 2423 DU_J19_
MSC_BOT
_Q79
Which one of the following is considered to be a
signal metabolite that regulates the partitioning
between sucrose and starch synthesis?
79 2422 DU_J19_
MSC_BOT
_Q78
High activity of sucrose synthase is present in
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
81 2424 DU_J19_
MSC_BOT
_Q80
Two different DNA molecules were isolated from a
bacterial sample. Further experiments
demonstrated that one of these (X) was composed
of 40%A, 40%G, 10%T and 10%C but could not
be cut by an exonuclease. The second DNA sample
(Y) could be cut by the exonuclease and was
found to be composed of 30%A, 30%T, 20%G and
20%C. Which one of the following statements can
be correctly deduced from the above?
9700: 5? ? ATGACGA ? 3? and 5? ?
CCGTGAC ? 3?,
9701:roots. ,
9702:callus. ,
9703:embryos. ,
9704:shoots. ,
9705:EPSPS? ,
9706:pat? ,
9707:ALS? ,
9708:nptII? ,
9709:They are generally composed of
larger fragments as compared to
genomic DNA libraries ,
9710:They can be used to study
alternatively spliced forms of a gene ,
9711:They can be used to study
quantitative variations in gene
expressions levels between different
tissues ,
9712:They can be used to analyse
variations in gene expression patterns
between different developmental stages
of a plant ,
9713:Maize ,
9714:Wheat ,
9715:Rice ,
9716:Barley ,
9717:genetically modified foods from
plants. ,
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
84 2427 DU_J19_
MSC_BOT
_Q83
Which one of the following genes?does not?confer
resistance to a herbicide?
83 2426 DU_J19_
MSC_BOT
_Q82
In plant tissue culture, a high cytokinin : auxin
ratio promotes the formation of
86 2429 DU_J19_
MSC_BOT
_Q85
Which one of the following crops was the first to
have its nuclear genome sequenced?
85 2428 DU_J19_
MSC_BOT
_Q84
Which one of the following statements about cDNA
libraries?is not?correct?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
9718:synthesis of drugs from transgenic
plants/animals. ,
9719:recombinant drugs from bacteria. ,
9720:large scale farming of medicinal
plants. ,
9721:NBPGR ,
9722:NBA ,
9723:GEAC ,
9724:NBRI ,
9725:Protoplast ? E.C. Cocking ,
9726:Edible vaccine ? C.J. Arntzen ,
9727:Somaclonal variation ? F.C.
Steward ,
9728:GUS reporter system ? R.A.
Jefferson ,
9729:homoplasy ,
9730:homology ,
9731:homonym ,
9732:convergence ,
9733:Amborella ?,
9734:Nymphaea? ,
9735:Magnolia? ,
9736:Hibiscus? ,
9737:protogyny ,
9738:protoandry ,
9739:dichogamy ,
9740:androdioecy ,
9741:All taxonomic keys are
dichotomous. ,
88 2431 DU_J19_
MSC_BOT
_Q87
Which of the following is the regulatory body
conferring approval for transgenic plants?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
90 2433 DU_J19_
MSC_BOT
_Q89
Similarity resulting from common ancestry is called
89 2432 DU_J19_
MSC_BOT
_Q88
Identify the?incorrect?combination from the
following:
92 2435 DU_J19_
MSC_BOT
_Q91
In species where pollen matures and is released
prior to the maturation and receptivity of the
gynoecium, the condition is called
91 2434 DU_J19_
MSC_BOT
_Q90
Which one of?the following is the most
primitive?basal angiosperm?
93 2436 DU_J19_
MSC_BOT
_Q92
Which one of the following statements?is
not?correct?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.
9684:Uronic Acid Pathways ,
9685:tissues that synthesize sucrose ,
9686:tissues that utilize sucrose ,
9687:photosynthetic leaves ,
9688:sucrose exporting tissue ,
9689:Fructose-2, 6-bisphosphate ,
9690:Fructose-1, 6-bisphosphate ,
9691:Fructose 6-phosphate ,
9692:Fructose 2-phosphate ,
9693:DNA X has a double-stranded and
linear structure ,
9694:DNA Y has a double-stranded and
circular structure ,
9695:DNA X has a single-stranded and
linear structure ,
9696:DNA X has a single-stranded and
circular structure ,
9697: 5? ? ATGACGA ? 3? and 5? ?
GTCACGG ? 3? ,
9698: 5? ? TACTGCT ? 3? and 5? ?
GGCACTG? 3? ,
9699: 5? ? TCGTCAT ? 3? and 5? ?
CCGTGAC ? 3? ,
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
80 2423 DU_J19_
MSC_BOT
_Q79
Which one of the following is considered to be a
signal metabolite that regulates the partitioning
between sucrose and starch synthesis?
79 2422 DU_J19_
MSC_BOT
_Q78
High activity of sucrose synthase is present in
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
81 2424 DU_J19_
MSC_BOT
_Q80
Two different DNA molecules were isolated from a
bacterial sample. Further experiments
demonstrated that one of these (X) was composed
of 40%A, 40%G, 10%T and 10%C but could not
be cut by an exonuclease. The second DNA sample
(Y) could be cut by the exonuclease and was
found to be composed of 30%A, 30%T, 20%G and
20%C. Which one of the following statements can
be correctly deduced from the above?
9700: 5? ? ATGACGA ? 3? and 5? ?
CCGTGAC ? 3?,
9701:roots. ,
9702:callus. ,
9703:embryos. ,
9704:shoots. ,
9705:EPSPS? ,
9706:pat? ,
9707:ALS? ,
9708:nptII? ,
9709:They are generally composed of
larger fragments as compared to
genomic DNA libraries ,
9710:They can be used to study
alternatively spliced forms of a gene ,
9711:They can be used to study
quantitative variations in gene
expressions levels between different
tissues ,
9712:They can be used to analyse
variations in gene expression patterns
between different developmental stages
of a plant ,
9713:Maize ,
9714:Wheat ,
9715:Rice ,
9716:Barley ,
9717:genetically modified foods from
plants. ,
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
84 2427 DU_J19_
MSC_BOT
_Q83
Which one of the following genes?does not?confer
resistance to a herbicide?
83 2426 DU_J19_
MSC_BOT
_Q82
In plant tissue culture, a high cytokinin : auxin
ratio promotes the formation of
86 2429 DU_J19_
MSC_BOT
_Q85
Which one of the following crops was the first to
have its nuclear genome sequenced?
85 2428 DU_J19_
MSC_BOT
_Q84
Which one of the following statements about cDNA
libraries?is not?correct?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
9718:synthesis of drugs from transgenic
plants/animals. ,
9719:recombinant drugs from bacteria. ,
9720:large scale farming of medicinal
plants. ,
9721:NBPGR ,
9722:NBA ,
9723:GEAC ,
9724:NBRI ,
9725:Protoplast ? E.C. Cocking ,
9726:Edible vaccine ? C.J. Arntzen ,
9727:Somaclonal variation ? F.C.
Steward ,
9728:GUS reporter system ? R.A.
Jefferson ,
9729:homoplasy ,
9730:homology ,
9731:homonym ,
9732:convergence ,
9733:Amborella ?,
9734:Nymphaea? ,
9735:Magnolia? ,
9736:Hibiscus? ,
9737:protogyny ,
9738:protoandry ,
9739:dichogamy ,
9740:androdioecy ,
9741:All taxonomic keys are
dichotomous. ,
88 2431 DU_J19_
MSC_BOT
_Q87
Which of the following is the regulatory body
conferring approval for transgenic plants?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
90 2433 DU_J19_
MSC_BOT
_Q89
Similarity resulting from common ancestry is called
89 2432 DU_J19_
MSC_BOT
_Q88
Identify the?incorrect?combination from the
following:
92 2435 DU_J19_
MSC_BOT
_Q91
In species where pollen matures and is released
prior to the maturation and receptivity of the
gynoecium, the condition is called
91 2434 DU_J19_
MSC_BOT
_Q90
Which one of?the following is the most
primitive?basal angiosperm?
93 2436 DU_J19_
MSC_BOT
_Q92
Which one of the following statements?is
not?correct?
9742:All keys comprise sequence of two
contrasting statements, each statement
is known as a lead. ,
9743:In a taxonomic key, the two leads
together comprise a couplet. ,
9744:Keys are based on phylogeny. ,
9745:Brassicaceae ,
9746:Papaveraceae ,
9747:Capparaceae ,
9748:Fabaceae ,
9749:zonocolpate ,
9750:zonoporate ,
9751:zonoaperturate ,
9752:colporate ,
9753:Autonym ,
9754:Tautonym ,
9755:Synonym ,
9756:Basionym ,
9757:Hordeum vulgare? ,
9758:Triticum aestivum ?,
9759:Cynodon dactylon? ,
9760:Secale cereale? ,
9761:Darjeeling ,
9762:Ootacamund ,
9763:Srinagar (Kashmir) ,
9764:Dehra Dun ,
9765:Inferae ,
9766:Heteromerae ,
9767:Bicarpoellatae ,
9768:Thalamiflorae ,
9769:Ranunculaceae ,
94 2437 DU_J19_
MSC_BOT
_Q93
Glucosinolates do not occur in
93 2436 DU_J19_
MSC_BOT
_Q92
Which one of the following statements?is
not?correct?
96 2439 DU_J19_
MSC_BOT
_Q95
A binomial in which the genus name and specific
epithet are identical in spelling is called
95 2438 DU_J19_
MSC_BOT
_Q94
A pollen grain with colpi occurring in the
equatorial region is called
98 2441 DU_J19_
MSC_BOT
_Q97
Lloyd Botanical Garden is located at
97 2440 DU_J19_
MSC_BOT
_Q96
Which one of the following?is not?a member of
Poaceae?
100 2443 DU_J19_
MSC_BOT
_Q99
Syngenesious stamens are characteristic of the
family
99 2442 DU_J19_
MSC_BOT
_Q98
Which series?is not?included in the Gamopetalae
in Bentham and Hooker?s system of classification?

FirstRanker.com - FirstRanker's Choice
Sr.No
Question
Id
Question

Descripti
on
Question Body Options
9377: barrels ,
9378:murins ,
9379:porins,
9380:granules ,
9381: peptidoglycan wall.,
9382:outer lipopolysaccharide layer.,
9383:porin protein.,
9384:teichoic acid. ,
9385: endospore ,
9386: sclerotium ,
9387:sporocarp ,
9388:heterocyst ,
9389: Bright field ,
9390: Phase contrast ,
9391:Fluorescent ,
9392: Differential interference contrast ,
9393: epipelic ,
9394:neustonic ,
9395: planktonic ,
9396: benthic,
9397: aragonite.,
9398: calcite. ,
9399: detritus. ,
9400: stromatolites. ,
9401: Lysine ,
DU MSc Botany
2 2346 DU_J19_
MSC_BOT
_Q02
Gram-negative bacteria are more resistant to
antibiotics than Gram-positive bacteria due to the
presence of
1 2345 DU_J19_
MSC_BOT
_Q01
Channel proteins that are located in the outer
membrane of Gram-negative bacteria are known
as
4 2348 DU_J19_
MSC_BOT
_Q04
Three-dimensional structures of a cell can be
studied by using which of the following
microscopes?
3 2347 DU_J19_
MSC_BOT
_Q03
Dormant, tough, non-reproductive structure,
produced by bacteria to tide over unfavourable
conditions is known as:
6 2350 DU_J19_
MSC_BOT
_Q06
Orthorhombic crystals of calcium carbonate are
known as
5 2349 DU_J19_
MSC_BOT
_Q05
Algae that grow at the interface of water and
atmosphere are called as
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
9402: Histidine ,
9403: Arginine ,
9404: Glycine,
9405: Methionine ,
9406: Valine ,
9407: Proline ,
9408: Lecithin ,
9409: at 25?C ,
9410: between 25-30?C ,
9411: at 15?C ,
9412: above 75?C ,
9413: Ivan Wallin ,
9414: Lynn Margulis ,
9415: Konstantin Mereschkowski ,
9416: Lynn Sagan,
9773:The grouping of taxa by overall
similarity is called phenetics. ,
9774:Verticillaster is the characteristic
inflorescence of Lamiaceae. ,
9775:Cypsela is characteristic fruit of
Poaceae ,
9776:Cremocarp is characterstic fruit of
Apiaceae ,
9417:2,
9418:4,
9419:6,
9420:8,
9421: Basidiomycetes. ,
9422: Ascomycetes. ,
9423: Zygomycetes. ,
8 2352 DU_J19_
MSC_BOT
_Q08
Which one of the following is a phospholipid?
7 2351 DU_J19_
MSC_BOT
_Q07
Which one of the following amino acids has a
nonpolar, aliphatic R group?
10 2354 DU_J19_
MSC_BOT
_Q10
The concept of symbiogenesis was first articulated
by
9 2353 DU_J19_
MSC_BOT
_Q09
Majority of the enzymes are inactive
12 2355 DU_J19_
MSC_BOT
_Q11
The number of nucleosomes associated with one
turn of solenoid configuration of chromatin is
11 2444 DU_J19_
MSC_BOT
_Q100
Which one of the following statements?is not?true?
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
9424: Chytridiomycetes.,
9425:?Phytophthora. ,
9426:?Alternaria. ?,
9427:?Fusarium.? ,
9428:?Botrytis.? ,
9429: cleistothecium. ,
9430: pseudothecium. ,
9431: perithecium. ,
9432: apothecium. ,
9433: sclerotium. ,
9434: vesicle. ,
9435: haustorium. ,
9436: sporophore.,
9437: Zygomycota ,
9438: Ascomycota ,
9439: Chytridiomycota ,
9440: Basidiomycota,
9441:Escherichia coli ?,
9442:Vaccinia virus ,
9443:Tobacco mosaic virus ,
9444:Tobacco necrosis satellite virus ,
9445:Riccia ?,
9446:Porella ?,
9447:Cooksonia ?,
9448:Sphagnum ?,
9449:In bryophytes, meiosis occurs in
the gametangia to produce sperms and
eggs ,
9450:In?Anthoceros, ?each cell contains
single large chloroplast with a pyrenoid ,
14 2357 DU_J19_
MSC_BOT
_Q13
Amphigynous antheridium is found in the genus
13 2356 DU_J19_
MSC_BOT
_Q12
Dolipore septum is a characteristic of
16 2359 DU_J19_
MSC_BOT
_Q15
A globular or hook-like intracellular structure
formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as
15 2358 DU_J19_
MSC_BOT
_Q14
The sexual fruiting body in?Neurospora ?is called as
18 2361 DU_J19_
MSC_BOT
_Q17
The smallest known virus is
17 2360 DU_J19_
MSC_BOT
_Q16
Which phylum contains organisms that most
closely resemble the common ancestor of fungi
and animals?
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
19 2362 DU_J19_
MSC_BOT
_Q18
Which one of the following contributes to the
formation of peatlands?
9451:Amphigastria are found in?Porella ?,
9452:In?Funaria, ?the dominant stage of
life cycle is gametophytic ,
9453: epidermis. ,
9454: amphithecium. ,
9455: endothecium. ,
9456: columella. ,
9457:Smooth walled as well as
tuberculated rhizoids ,
9458:Barrel shaped epidermal pores in
the thallus ,
9459:Elaters ,
9460:Filamentous protonema ,
9461: lateral conducting channel for
water in the leaves. ,
9462: mucilage secreting tissue in the
ducts. ,
9463: micropyle closing tissue after
pollination. ,
9464: nutritive tissue for embryo. ,
9465:Pycnoxylic in?Pinus , and manoxylic
in?Cycas? ,
9466:Manoxylic in?Pinus , and pycnoxylic
in?Cycas? ,
9467:Pycnoxylic in both ,
9468:Manoxylic in both ,
9469:The secondary wood contains
vessels. ,
20 2363 DU_J19_
MSC_BOT
_Q19
Which one of the following
statements?is?not?correct?
22 2365 DU_J19_
MSC_BOT
_Q21
Which one of the following?is not?found
in?Marchantia? ?
21 2364 DU_J19_
MSC_BOT
_Q20
In?Pellia, ?the sporogenous tissue develops from
the
24 2367 DU_J19_
MSC_BOT
_Q23
Which type of wood is found in?Pinus? and?Cycas ??
23 2366 DU_J19_
MSC_BOT
_Q22
Transfusion tissue in Cycas functions as
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
9470:Tapetal layer is completely absent
in the microsporangium. ,
9471:The female gametophyte is formed
before fertilization. ,
9472:There are no distinct archegonia,
and some free nuclei of the female
gametophyte function as eggs. ,
9473:adaxial surface and abaxial surface
of the sporophylls, respectively ,
9474:abaxial surface and adaxial surface
of the sporophylls, respectively ,
9475:adaxial surface of the sporophylls ,
9476:abaxial surface of the sporophylls ,
9477: cells in the root epidermis that
gives rise to root hair ,
9478: epidermal outgrowths that may or
may not be glandular,
9479: cells that markedly differ from
other cells in the same tissue ,
9480: excessively multiplying cells in the
root epidermis ,
26 2369 DU_J19_
MSC_BOT
_Q25
The microsporangia in the male cone and ovules
in female cones of?Pinus ?are positioned on the
25 2368 DU_J19_
MSC_BOT
_Q24
Which of the following statements is NOT correct
about?Gnetum ?
27 2370 DU_J19_
MSC_BOT
_Q26
Trichoblasts are
9481:They are formed by the higher
activity of phellogen in some limited
areas of the periderm ,
9482:They permit the entry of air
through the peridem ,
9483:They are found in stems as well as
roots ,
9484:They start appearing during the
early stages of primary growth ,
9485:occurring in mesophytic plants. ,
9486:in which all the subsidiary cells
have a common origin with guard cells. ,
9487:having subsidiary cells that are
indistinguishable from other epidermal
cells. ,
9488:having subsidiary cells that are
aligned parallel to the long axis of the
guard cells. ,
9489: lack of trichomes. ,
9490: presence of bristly hair. ,
9491: sparsely hairy.,
9492: presence of glandular trichomes. ,
9493: osmophores ,
9494: hydathodes ,
9495: nectaries ,
9496: myrosine cells ,
28 2371 DU_J19_
MSC_BOT
_Q27
Which of the following statement is?not
true?about lenticels?
30 2373 DU_J19_
MSC_BOT
_Q29
The term ?Glabrous? refers to
29 2372 DU_J19_
MSC_BOT
_Q28
Mesogenous stomata refers to stomata
31 2374 DU_J19_
MSC_BOT
_Q30
Volatile substances that attract pollinators are
emitted by
9497: meristematic region located in the
rib zone of Shoot Apical Meristem (SAM) ,
9498: intercalary meristem ,
9499: marginal meristem of growing
leaves ,
9500: quiescent centre of Root Apical
Meristem (RAM) ,
9501: substitute fibers ,
9502: libriform fibers ,
9503: gelatinous fibers ,
9504: fiber-tracheids,
9505: resin droplets accumulated in the
non-conducting vessel elements ,
9506: wall ingrowths that impart sieve-
like appearance to pits of the vessels ,
9507: Plasmodesmatal connections
between any wood elements ,
9508: clogged hydathodes ,
9509: Chenopodiaceae ,
9510: Bignoniaceae ,
9511: Apocynaceae ,
9512: Asclepiadaceae ,
9513:?Carica papaya? ,
9514:?Punica granatum? ,
9515:?Tamarindus indica? ,
9516:?Mangifera indica? ,
9517:?Gymnema sylvestre? ,
9518:?Stevia rebaudiana ?,
32 2375 DU_J19_
MSC_BOT
_Q31
Blastozone refers to the
34 2377 DU_J19_
MSC_BOT
_Q33
Vestures refer to
33 2376 DU_J19_
MSC_BOT
_Q32
Hygroscopic fibers located in the reaction wood
are termed as
36 2379 DU_J19_
MSC_BOT
_Q35
Which of the following fruits?do not?have edible
mesocarp?
35 2378 DU_J19_
MSC_BOT
_Q34
Accessory cambia, the activity of which leads to
formation of a series of cylinders of secondary
vascular tissues are found in
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
9519:?Syzygium cumini? ,
9520:?Carica papaya? ,
9521:Terminalia bellerica? ,
9522:Terminalia arjuna? ,
9523:Terminalia officinalis? ,
9524:Emblica officinalis? ,
9525:Litchi chinensis? and?Aegle
marmelos? ,
9526:Myristica fragrans? and?Litchi
chinensis? ,
9527:Vitis vinifera? and?Aegle marmelos? ,
9528:Litchi chinensis? and?Ananas
cosmosus? ,
9529:Betula bhojpatra ? bhojpatra ,
9530:Diospyros melanoxylon ? Indian
beedi ,
9531:Pongamia pinnata ? biodiesel ,
9532:Cichorium intybus ? ?khus-khus ,
9533:Pyrethrin, Azadirachtin, Spilanthol ,
9534:Azadirachtin, Taxol, Curcumin ,
9535:Pyrethrin, Jatrophine, Curcumin ,
9536:Capsaicin, Citronella oil, Piperine ,
9537:essential oils. ,
9538:proteins. ,
38 2381 DU_J19_
MSC_BOT
_Q37
Which one of the following?is not?a constituent of
an ayurvedic herbal formulation, ?Trifala??
37 2380 DU_J19_
MSC_BOT
_Q36
Which one of the following is used as a sweetener?
40 2383 DU_J19_
MSC_BOT
_Q39
Which one of the following is
an?incorrect?combination?
39 2382 DU_J19_
MSC_BOT
_Q38
Fruits of which of the following pair of plants
possess aril?
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
41 2384 DU_J19_
MSC_BOT
_Q40
Which one of the following sets of compounds is
used as biopesticides?
9539:starch grains. ,
9540:dietary fibers. ,
9541:Papilionaceae ,
9542:Asteraceae ,
9543:Lamiaceae ,
9544:Apiaceae ,
9545:1; 2, 2 ,
9546:2; 2, 1 ,
9547:1; 2, 1 ,
9548:2; 2, 1 ,
9549:The population will not exhibit
Hardy-Weinberg equilibrium. ,
9550:The genotypic frequencies can be
estimated if the allele frequencies are
known. ,
9551:At a given point of time for any
given bi-allelic gene, the sum of the
allele frequencies would be equal to one.
,
9552:At a given point of time, the sum
total of all genotypic frequencies is equal
to 1. ,
9553:intragenic recombination occurs
only in phages. ,
9554:of the large number of phage
progeny that could be screened. ,
9555:making crosses in phages is easier.
,
42 2385 DU_J19_
MSC_BOT
_Q41
Aleurone layer is rich in
44 2387 DU_J19_
MSC_BOT
_Q43
In a population of diploid individuals, six alleles
exist for a particular gene. What is the expected
number of alleles present in a chromosome; and
types of alleles in a heterozygous individual and in
a homozygous individual respectively?
43 2386 DU_J19_
MSC_BOT
_Q42
Gynobasic style is a characteristic feature of the
family
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
45 2388 DU_J19_
MSC_BOT
_Q44
Which one of the following statements?is false?for
a population that is under natural selection?
9556:phages have haploid genomes. ,
9557:Mendelian inheritance ,
9558:Cytoplasmic maternal inheritance ,
9559:Cytoplasmic maternal effect ,
9560:Epistasis ,
9561:X-linked inheritance ,
9562:Y-linked inheritance ,
9563:Mitochondrial inheritance ,
9564:Autosomal inheritance ,
9565:It is also called as Fluctuation Test ,
9566:It demonstrated that genetic
mutations arise in the absence of
selection, and not as a response to
selection. ,
9567:They inoculated equal number
of?E .?coli ?into separate culture tubes
with and without T1 phage. ,
9568:Equal number of T1 phage
resistant colonies were obtained in all
the plates. ,
46 2389 DU_J19_
MSC_BOT
_Q45
In the fine mapping of?rII ?locus, Benzer was able
to demonstrate intragenic recombination in
phages mainly because
48 2391 DU_J19_
MSC_BOT
_Q47
Study the following pedigree. What can be the
possible inheritance pattern?
47 2390 DU_J19_
MSC_BOT
_Q46
In?Lymnaea peregra , coiling behaviour is
controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ?D? and
sinistral coiling by recessive allele ?d?. When a
cross is made using sinistral as female and dextral
as male, all the snails are sinistral in F1?and
dextral in F2. Again in F3?a ratio of 3 dextral and 1
49 2392 DU_J19_
MSC_BOT
_Q48
Which of the following is?not true?about the
classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning
team of Max Luria and Salvador Delbruck?
9569:The percentage of all the four
types of gametes (AB, ab, Ab, aB) would
be equal. ,
9570:Gametes with genotype AB and ab
will be less than those with aB and Ab. ,
9571:Both loci will segregate in a 3:1
ratio. ,
9572:The segregation ratio of the two
genes will depend upon the distance
between them. ,
9573:I-2; II-1; III-4; IV-3 ,
9574:I-4; II-3; III-1; IV-2 ,
9575:I-4; II-3; III-2; IV-1 ,
9576:I-3; II-4; III-2; IV-1 ,
9577:?-70 ,
9578:?-70 ,
9579:?-55 ,
9580:?-70 ,
9581: RNA Polymerase I ,
9582: RNA polymerase II ,
9583: RNA Polymerase III ,
9584: RNA polymerase IV ,
9585: System Ecology. ,
9586: Ecosystem Ecology. ,
9587: Urban Ecology.,
9588: Social Ecology. ,
9589: O ,
9590: A ,
9591: B ,
9592: C ,
50 2393 DU_J19_
MSC_BOT
_Q49
A plant heterozygous for two tightly linked genes
A and B, has the genotype AB/ab. Which of the
following statements is?truewhen the plant is self-
pollinated?
52 2395 DU_J19_
MSC_BOT
_Q51
The factor responsible for mediating binding of
core RNA polymerase to promoter is
51 2394 DU_J19_
MSC_BOT
_Q50
Mark the correct pairing of scientists and their
contributions?I Nirenberg and Matthei ? ? ? ? ? ? ? ? ?
? ? ?1 Telomerase?II Sidney Altman and Thomas
Cech ? ? ??2 DNA Polymerase I?III Arthur Kornberg
? ? ? ? ? ? ? ? ? ? ? ? ? ? ?3 Ribozyme?IV Elizabeth
54 2397 DU_J19_
MSC_BOT
_Q53
The study of man-made areas with complex,
dynamic ecological systems, influenced by
interconnected biological, physical and social
components is called as
53 2396 DU_J19_
MSC_BOT
_Q52
Which of the following enzyme is involved in tRNA
synthesis?
55 2398 DU_J19_
MSC_BOT
_Q54
Which of the following horizons in the soil profile
has high amount of organic matter?
9593:80 ?C ,
9594:50 ?C ,
9595:60 ?C ,
9596:40 ?C ,
9597:Random. ,
9598:Regular. ,
9599:Clumped. ,
9600:Contiguous. ,
9601:Alkaloids ,
9602:Phenols ,
9603:Terpenoids ,
9604:Pheromones ,
9605:Survivorship curve ,
9606:Static life table ,
9607:Cohort life table ,
9608:Natality ,
9609: Dominance ,
9610: General diversity ,
9611: Evenness ,
9612: Similarity-dissimilarity ,
9613:It is a highly convoluted extension
of the micropylar portion of the synergid
wall. ,
9614:It increases the surface area of the
plasma membrane of synergids. ,
9615:It controls pollen tube growth. ,
9616:It determines the polarity of the
egg apparatus. ,
56 2399 DU_J19_
MSC_BOT
_Q55
Hyperthermophiles are heat loving microbes that
can live in temperature optima above
58 2401 DU_J19_
MSC_BOT
_Q57
Which of the following chemical substances are
secreted by some animals for communication with
other members of their species?
57 2400 DU_J19_
MSC_BOT
_Q56
A distribution in which individuals within a
population have an equal chance of living
anywhere within an area is called as
60 2403 DU_J19_
MSC_BOT
_Q59
The Shannon-Weiner index measures:
59 2402 DU_J19_
MSC_BOT
_Q58
The probability of death of organisms with
different ages in the current year is shown in
61 2404 DU_J19_
MSC_BOT
_Q60
Which of the following statements on filiform
apparatus is?not?correct?
9617:a cap-like structure of cutinized
cells above the embryo sac. ,
9618:a group of cells below the embryo
sac and above the funiculus. ,
9619:nucellar cells above the embryo
sac. ,
9620:parietal cells. ,
9621:Poaceae ,
9622:Podostemaceae ,
9623:Brassicaceae ,
9624:Papilionaceae ,
9625:Epidermis ,
9626:Aerenchyma ,
9627:Hypodermis ,
9628:Aril ,
9629:The first and second meiotic
divisions result in a tetrad of
megaspores. ,
9630:Three megaspores degenerate
while functional haploid megaspore
undergoes megagametogenesis. ,
9631:All the four megaspores
degenerate while an aposporous initial
forms the embryo sac. ,
9632:Tetrad is surrounded by a callose
wall. ,
9633:Amborellaceae. ,
9634:Anacardiaceae. ,
9635:Annonaceae. ,
9636:Agavaceae. ,
62 2405 DU_J19_
MSC_BOT
_Q61
Hypostase refers to
64 2407 DU_J19_
MSC_BOT
_Q63
Which of the following parts?is not?observed in a
mature seed-coat?
63 2406 DU_J19_
MSC_BOT
_Q62
The members of which of the following
angiosperm families?do not?form endosperm?
66 2409 DU_J19_
MSC_BOT
_Q65
Polysporangiate anthers are seen in the family
65 2408 DU_J19_
MSC_BOT
_Q64
Which one of the following statements?is not?true
for aposporous embryo sac development?
9637:Acid phosphatases and esterases ,
9638:Pectinases and catalases ,
9639:Lipases and cutinases ,
9640:Kinases and ?-1,3 glucanase ,
9641:longitudinal dehiscence. ,
9642:valvular dehiscence. ,
9643:poricidal dehiscence. ,
9644:explosive dehiscence. ,
9645:P. Maheshwari. ,
9646:E. Strasburger. ,
9647:J. Heslop-Harrison. ,
9648:S.G. Nawaschin. ,
9649:Aquaporins are found in both plant
and animal cell membranes. ,
9650:Phosphorylation and calcium
concentration regulates aquaporin
activity. ,
9651:Activity of aquaporin is regulated
by pH and reactive oxygen species. ,
9652:Aquaporins cannot transport
uncharged molecules like NH3. ,
9653:-2.3 bar. ,
9654:+2.3 bar. ,
9655:0 bar. ,
9656:1 bar. ,
68 2411 DU_J19_
MSC_BOT
_Q67
Buzz pollination is associated with flowers,
wherein the anthers exhibit
67 2410 DU_J19_
MSC_BOT
_Q66
In a pollen wall, the following enzymes serve as
markers for intine and exine, respectively.
70 2413 DU_J19_
MSC_BOT
_Q69
Which of the following statements?is not?correct
about aquaporins?
69 2412 DU_J19_
MSC_BOT
_Q68
Fluorochromatic reaction test to ascertain pollen
viability was developed by
71 2414 DU_J19_
MSC_BOT
_Q70
The water potential of pure water at atmospheric
pressure is
9657:transports oxygen to the root
nodule. ,
9658:acts as an oxygen scavenger. ,
9659:provides energy to the nitrogen
fixing bacterium. ,
9660:acts as a catalyst in
transamination. ,
9661:730 nm. ,
9662:660 nm. ,
9663:466 nm. ,
9664:650 nm. ,
9665:Both ferrous and ferric ions ,
9666:Fe-Chelate ,
9667:Ferrous ions ,
9668:Ferric ions ,
9669:Abscisic acid ,
9670:Indole acetic acid ,
9671:Cytokinins ,
9672:Ethylene ,
9673:phosphorylation-dephosphorylation
,
9674:oxidation-reduction ,
9675:carboxylation-decarboxylation ,
9676:isomerization ,
9677:4 ,
9678:2 ,
9679:8 ,
9680:14 ,
9681:Glycogenolysis ,
9682:Citric Acid Cycle ,
9683:Glyconeogenesis ,
72 2415 DU_J19_
MSC_BOT
_Q71
In root nodules of legumes, leg-haemoglobin is
important because it
74 2417 DU_J19_
MSC_BOT
_Q73
In non-graminaceous plant roots, iron is
transported across the plasma membrane as
73 2416 DU_J19_
MSC_BOT
_Q72
Pfr shows maximum absorption at
76 2419 DU_J19_
MSC_BOT
_Q75
PEP carboxylase activity in C4?and CAM plants is
regulated by
75 2418 DU_J19_
MSC_BOT
_Q74
Methionine is the precursor of which of the
following plant growth regulators?
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
77 2420 DU_J19_
MSC_BOT
_Q76
One molecule of Calmodulin, a calcium binding
protein in eukaryotic cells binds to______
Ca2+?ions.
9684:Uronic Acid Pathways ,
9685:tissues that synthesize sucrose ,
9686:tissues that utilize sucrose ,
9687:photosynthetic leaves ,
9688:sucrose exporting tissue ,
9689:Fructose-2, 6-bisphosphate ,
9690:Fructose-1, 6-bisphosphate ,
9691:Fructose 6-phosphate ,
9692:Fructose 2-phosphate ,
9693:DNA X has a double-stranded and
linear structure ,
9694:DNA Y has a double-stranded and
circular structure ,
9695:DNA X has a single-stranded and
linear structure ,
9696:DNA X has a single-stranded and
circular structure ,
9697: 5? ? ATGACGA ? 3? and 5? ?
GTCACGG ? 3? ,
9698: 5? ? TACTGCT ? 3? and 5? ?
GGCACTG? 3? ,
9699: 5? ? TCGTCAT ? 3? and 5? ?
CCGTGAC ? 3? ,
78 2421 DU_J19_
MSC_BOT
_Q77
Anabolic component of the carbohydrate
metabolism includes which one of the following
processes?
80 2423 DU_J19_
MSC_BOT
_Q79
Which one of the following is considered to be a
signal metabolite that regulates the partitioning
between sucrose and starch synthesis?
79 2422 DU_J19_
MSC_BOT
_Q78
High activity of sucrose synthase is present in
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
81 2424 DU_J19_
MSC_BOT
_Q80
Two different DNA molecules were isolated from a
bacterial sample. Further experiments
demonstrated that one of these (X) was composed
of 40%A, 40%G, 10%T and 10%C but could not
be cut by an exonuclease. The second DNA sample
(Y) could be cut by the exonuclease and was
found to be composed of 30%A, 30%T, 20%G and
20%C. Which one of the following statements can
be correctly deduced from the above?
9700: 5? ? ATGACGA ? 3? and 5? ?
CCGTGAC ? 3?,
9701:roots. ,
9702:callus. ,
9703:embryos. ,
9704:shoots. ,
9705:EPSPS? ,
9706:pat? ,
9707:ALS? ,
9708:nptII? ,
9709:They are generally composed of
larger fragments as compared to
genomic DNA libraries ,
9710:They can be used to study
alternatively spliced forms of a gene ,
9711:They can be used to study
quantitative variations in gene
expressions levels between different
tissues ,
9712:They can be used to analyse
variations in gene expression patterns
between different developmental stages
of a plant ,
9713:Maize ,
9714:Wheat ,
9715:Rice ,
9716:Barley ,
9717:genetically modified foods from
plants. ,
82 2425 DU_J19_
MSC_BOT
_Q81
The 5? ? 3? nucleotide sequence of one of the
strands of a double stranded DNA molecule is
given below: 5? ?
ATGACGATGGACACATGACATAGACGATAATGCCGTG
AC ? 3? In the absence of Tm?effects, which one of
the following sets of primers could, theoretically,
be used to amplify the target sequence by PCR?
84 2427 DU_J19_
MSC_BOT
_Q83
Which one of the following genes?does not?confer
resistance to a herbicide?
83 2426 DU_J19_
MSC_BOT
_Q82
In plant tissue culture, a high cytokinin : auxin
ratio promotes the formation of
86 2429 DU_J19_
MSC_BOT
_Q85
Which one of the following crops was the first to
have its nuclear genome sequenced?
85 2428 DU_J19_
MSC_BOT
_Q84
Which one of the following statements about cDNA
libraries?is not?correct?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
9718:synthesis of drugs from transgenic
plants/animals. ,
9719:recombinant drugs from bacteria. ,
9720:large scale farming of medicinal
plants. ,
9721:NBPGR ,
9722:NBA ,
9723:GEAC ,
9724:NBRI ,
9725:Protoplast ? E.C. Cocking ,
9726:Edible vaccine ? C.J. Arntzen ,
9727:Somaclonal variation ? F.C.
Steward ,
9728:GUS reporter system ? R.A.
Jefferson ,
9729:homoplasy ,
9730:homology ,
9731:homonym ,
9732:convergence ,
9733:Amborella ?,
9734:Nymphaea? ,
9735:Magnolia? ,
9736:Hibiscus? ,
9737:protogyny ,
9738:protoandry ,
9739:dichogamy ,
9740:androdioecy ,
9741:All taxonomic keys are
dichotomous. ,
88 2431 DU_J19_
MSC_BOT
_Q87
Which of the following is the regulatory body
conferring approval for transgenic plants?
87 2430 DU_J19_
MSC_BOT
_Q86
The term "Bio-pharming" refers to
90 2433 DU_J19_
MSC_BOT
_Q89
Similarity resulting from common ancestry is called
89 2432 DU_J19_
MSC_BOT
_Q88
Identify the?incorrect?combination from the
following:
92 2435 DU_J19_
MSC_BOT
_Q91
In species where pollen matures and is released
prior to the maturation and receptivity of the
gynoecium, the condition is called
91 2434 DU_J19_
MSC_BOT
_Q90
Which one of?the following is the most
primitive?basal angiosperm?
93 2436 DU_J19_
MSC_BOT
_Q92
Which one of the following statements?is
not?correct?
9742:All keys comprise sequence of two
contrasting statements, each statement
is known as a lead. ,
9743:In a taxonomic key, the two leads
together comprise a couplet. ,
9744:Keys are based on phylogeny. ,
9745:Brassicaceae ,
9746:Papaveraceae ,
9747:Capparaceae ,
9748:Fabaceae ,
9749:zonocolpate ,
9750:zonoporate ,
9751:zonoaperturate ,
9752:colporate ,
9753:Autonym ,
9754:Tautonym ,
9755:Synonym ,
9756:Basionym ,
9757:Hordeum vulgare? ,
9758:Triticum aestivum ?,
9759:Cynodon dactylon? ,
9760:Secale cereale? ,
9761:Darjeeling ,
9762:Ootacamund ,
9763:Srinagar (Kashmir) ,
9764:Dehra Dun ,
9765:Inferae ,
9766:Heteromerae ,
9767:Bicarpoellatae ,
9768:Thalamiflorae ,
9769:Ranunculaceae ,
94 2437 DU_J19_
MSC_BOT
_Q93
Glucosinolates do not occur in
93 2436 DU_J19_
MSC_BOT
_Q92
Which one of the following statements?is
not?correct?
96 2439 DU_J19_
MSC_BOT
_Q95
A binomial in which the genus name and specific
epithet are identical in spelling is called
95 2438 DU_J19_
MSC_BOT
_Q94
A pollen grain with colpi occurring in the
equatorial region is called
98 2441 DU_J19_
MSC_BOT
_Q97
Lloyd Botanical Garden is located at
97 2440 DU_J19_
MSC_BOT
_Q96
Which one of the following?is not?a member of
Poaceae?
100 2443 DU_J19_
MSC_BOT
_Q99
Syngenesious stamens are characteristic of the
family
99 2442 DU_J19_
MSC_BOT
_Q98
Which series?is not?included in the Gamopetalae
in Bentham and Hooker?s system of classification?
9770:Malvaceae ,
9771:Asteraceae ,
9772:Brassicaceae ,
100 2443 DU_J19_
MSC_BOT
_Q99
Syngenesious stamens are characteristic of the
family

FirstRanker.com - FirstRanker's Choice

This post was last modified on 19 June 2020