DUET Last 10 Years 2011-2021 Question Papers With Answer Key || Delhi University Entrance Test conducted by the NTA
| Sr.No | Question Body | Options | Id | Description |
|---|---|---|---|---|
| 1 | Channel proteins that are located in the outer membrane of Gram-negative bacteria are known as | 9377: barrels, 9378:murins 9379:porins, 9380:granules, | DU_J19_MSC_BOT_Q01 | |
| 2 | Gram-negative bacteria are more resistant to antibiotics than Gram-positive bacteria due to the presence of | 9381: peptidoglycan wall., 9382:outer lipopolysacchar 9383:porin protein., 9384:teichoic acid. | DU_J19_MSC_BOT_Q02 | |
| 3 | Dormant, tough, non-reproductive structure, produced by bacteria to tide over unfavourable conditions is known as: | 9385: endospore, 9386: sclerotium 9387:sporocarp, 9388:heterocyst, | DU_J19_MSC_BOT_Q03 | |
| 4 | Three-dimensional structures of a cell can be studied by using which of the following microscopes? | 9389: Bright field, 9390: Phase contrast, 9391:Fluorescent, 9392: Differential interfere | DU_J19_MSC_BOT_Q04 | |
| 5 | Algae that grow at the interface of water and atmosphere are called as | 9393: epipelic, 9394:neustonic, 9395: planktonic, 9396: benthic, | DU_J19_MSC_BOT_Q05 | |
| 6 | Orthorhombic crystals of calcium carbonate are known as | 9397: aragonite., 9398: calcite. 9399: detritus. 9400: stromatolites., | DU_J19_MSC_BOT_Q06 | |
| 7 | Which one of the following amino acids has a nonpolar, aliphatic R group? | 9401: Lysine, 9402: Histidine 9403: Arginine 9404: Glycine 9405: Methionine 9406: Valine 9407: Proline | DU_J19_MSC_BOT_Q07 | |
| 8 | Which one of the following is a phospholipid? | 9408: Lecithin | DU_J19_MSC_BOT_Q08 | |
| 9 | Majority of the enzymes are inactive | 9409: at 25°C 9410: between 25-30°C 9411: at 15°C 9412: above 75°C | DU_J19_MSC_BOT_Q09 | |
| 10 | The concept of symbiogenesis was first articulated by | 9413: Ivan Wallin 9414: Lynn Margulis 9415: Konstantin Mereschk 9416: Lynn Sagan | DU_J19_MSC_BOT_Q10 | |
| 11 | Which one of the following statements is not true? | 9773:The grouping of taxa similarity is called phenetic 9774:Verticillaster is the ch inflorescence of Lamiaceae 9775:Cypsela is characteris Poaceae, 9776:Cremocarp is charact Apiaceae | DU_J19_MSC_BOT_Q100 | |
| 12 | The number of nucleosomes associated with one turn of solenoid configuration of chromatin is | 9417:2, 9418:4, 9419:6, 9420:8, | DU_J19_MSC_BOT_Q11 | |
| 13 | Dolipore septum is a characteristic of | 9421: Basidiomycetes., 9422: Ascomycetes., 9423: Zygomycetes., 9424: Chytridiomycetes., | DU_J19_MSC_BOT_Q12 | |
| 14 | Amphigynous antheridium is found in the genus | 9425: Phytophthora., 9426: Alternaria. 9427: Fusarium. 9428: Botrytis., | DU_J19_MSC_BOT_Q13 | |
| 15 | The sexual fruiting body in Neurospora is called as | 9429: cleistothecium., 9430: pseudothecium., 9431: perithecium. 9432: apothecium., | DU_J19_MSC_BOT_Q14 | |
| 16 | A globular or hook-like intracellular structure formed by a biotrophic fungus/oomycete for absorption of nutrients from the host is known as | 9433: sclerotium., 9434: vesicle., 9435: haustorium. 9436: sporophore., | DU_J19_MSC_BOT_Q15 | |
| 17 | Which phylum contains organisms that most closely resemble the common ancestor of fungi and animals? | 9437: Zygomycota 9438: Ascomycota 9439: Chytridiomycota 9440: Basidiomycota | DU_J19_MSC_BOT_Q16 | |
| 18 | The smallest known virus is | 9441:Escherichia coli 9442:Vaccinia virus 9443:Tobacco mosaic virus 9444:Tobacco necrosis sate | DU_J19_MSC_BOT_Q17 | |
| 19 | Which one of the following contributes to the formation of peatlands? | 9445:Riccia 9446:Porella 9447:Cooksonia 9448:Sphagnum | DU_J19_MSC_BOT_Q18 | |
| 20 | Which one of the following statements is not correct? | 9449:In bryophytes, meios the gametangia to produce eggs 9450:In Anthoceros, each single large chloroplast wit 9451:Amphigastria are fou 9452:In Funaria, the domi life cycle is gametophytic | DU_J19_MSC_BOT_Q19 | |
| 21 | In Pellia, the sporogenous tissue develops from the | 9453: epidermis. 9454: amphithecium., 9455: endothecium., 9456: columella. | DU_J19_MSC_BOT_Q20 | |
| 22 | Which one of the following is not found in Marchantia ? | 9457:Smooth walled as we tuberculated rhizoids 9458: Barrel shaped epideri the thallus 9459: Elaters 9460:Filamentous protoner | DU_J19_MSC_BOT_Q21 | |
| 23 | Transfusion tissue in Cycas functions as | 9461: lateral conducting ch water in the leaves. 9462: mucilage secreting t ducts., 9463: micropyle closing tis pollination., 9464: nutritive tissue for e | DU_J19_MSC_BOT_Q22 | |
| 24 | Which type of wood is found in Pinus and Cycas ? | 9465:Pycnoxylic in Pinus, a in Cycas 9466:Manoxylic in Pinus, a in Cycas 9467:Pycnoxylic in both 9468:Manoxylic in both | DU_J19_MSC_BOT_Q23 | |
| 25 | Which of the following statements is NOT correct about Gnetum ? | 9469:The secondary wood vessels., 9470:Tapetal layer is comp in the microsporangium., 9471:The female gametoph before fertilization., 9472:There are no distinct and some free nuclei of the gametophyte function as e | DU_J19_MSC_BOT_Q24 | |
| 26 | The microsporangia in the male cone and ovules in female cones of Pinus are positioned on the | 9473:adaxial surface and a of the sporophylls, respecti 9474:abaxial surface and a of the sporophylls, respecti 9475:adaxial surface of the 9476:abaxial surface of the | DU_J19_MSC_BOT_Q25 | |
| 27 | Trichoblasts are | 9477: cells in the root epid gives rise to root hair 9478: epidermal outgrowth may not be glandular 9479: cells that markedly c other cells in the same tiss 9480: excessively multiplyi root epidermis | DU_J19_MSC_BOT_Q26 | |
| 28 | Which of the following statement is not true about lenticels? | 9481:They are formed by t activity of phellogen in som areas of the periderm 9482:They permit the entr through the peridem 9483:They are found in ste roots 9484:They start appearing early stages of primary gro | DU_J19_MSC_BOT_Q27 | |
| 29 | Mesogenous stomata refers to stomata | 9485:occurring in mesophy 9486:in which all the subsi have a common origin with 9487:having subsidiary cel indistinguishable from othe cells.. 9488:having subsidiary cel aligned parallel to the long guard cells., | DU_J19_MSC_BOT_Q28 | |
| 30 | The term 'Glabrous' refers to | 9489: lack of trichomes. 9490: presence of bristly h 9491: sparsely hairy., 9492: presence of glandula | DU_J19_MSC_BOT_Q29 | |
| 31 | Volatile substances that attract pollinators are emitted by | 9493: osmophores 9494: hydathodes 9495: nectaries 9496: myrosine cells | DU_J19_MSC_BOT_Q30 | |
| 32 | Blastozone refers to the | 9497: meristematic region rib zone of Shoot Apical Me 9498: intercalary meristem 9499: marginal meristem c leaves 9500: quiescent centre of F Meristem (RAM) | DU_J19_MSC_BOT_Q31 | |
| 33 | Hygroscopic fibers located in the reaction wood are termed as | 9501: substitute fibers 9502: libriform fibers 9503: gelatinous fibers 9504: fiber-tracheids | DU_J19_MSC_BOT_Q32 | |
| 34 | Vestures refer to | 9505: resin droplets accum non-conducting vessel elen 9506: wall ingrowths that i like appearance to pits of tl 9507: Plasmodesmatal con between any wood elemen 9508: clogged hydathodes | DU_J19_MSC_BOT_Q33 | |
| 35 | Accessory cambia, the activity of which leads to formation of a series of cylinders of secondary vascular tissues are found in | 9509: Chenopodiaceae 9510: Bignoniaceae 9511: Apocynaceae 9512: Asclepiadaceae | DU_J19_MSC_BOT_Q34 | |
| 36 | Which of the following fruits do not have edible mesocarp? | 9513: Carica papaya 9514: Punica granatum 9515: Tamarindus indica 9516: Mangifera indica | DU_J19_MSC_BOT_Q35 | |
| 37 | Which one of the following is used as a sweetener? | 9517: Gymnema sylvestre 9518: Stevia rebaudiana 9519: Syzygium cumini 9520: Carica papaya | DU_J19_MSC_BOT_Q36 | |
| 38 | Which one of the following is not a constituent of an ayurvedic herbal formulation, 'Trifala'? | 9521:Terminalia bellerica 9522:Terminalia arjuna 9523: Terminalia officinalis 9524:Emblica officinalis | DU_J19_MSC_BOT_Q37 | |
| 39 | Fruits of which of the following pair of plants possess aril? | 9525: Litchi chinensis and marmelos 9526:Myristica fragrans am chinensis 9527:Vitis vinifera and Aeg 9528: Litchi chinensis and cosmosus | DU_J19_MSC_BOT_Q38 | |
| 40 | Which one of the following is an incorrect combination? | 9529:Betula bhojpatra b 9530:Diospyros melanoxyl beedi 9531:Pongamia pinnata 9532:Cichorium intybus | DU_J19_MSC_BOT_Q39 | |
| 41 | Which one of the following sets of compounds is used as biopesticides? | 9533:Pyrethrin, Azadiracht 9534:Azadirachtin, Taxol, C 9535:Pyrethrin, Jatrophine 9536:Capsaicin, Citronella | DU_J19_MSC_BOT_Q40 | |
| 42 | Aleurone layer is rich in | 9537:essential oils., 9538: proteins. 9539:starch grains., 9540:dietary fibers. | DU_J19_MSC_BOT_Q41 | |
| 43 | Gynobasic style is a characteristic feature of the family | 9541:Papilionaceae 9542:Asteraceae 9543: Lamiaceae 9544:Apiaceae | DU_J19_MSC_BOT_Q42 | |
| 44 | In a population of diploid individuals, six alleles exist for a particular gene. What is the expected number of alleles present in a chromosome; and types of alleles in a heterozygous individual and in a homozygous individual respectively? | 9545:1; 2, 2 9546:2; 2, 1 9547:1; 2, 1 9548:2; 2, 1 | DU_J19_MSC_BOT_Q43 | |
| 45 | Which one of the following statements is false for a population that is under natural selection? | 9549: The population will no Hardy-Weinberg equilibriur 9550: The genotypic freque estimated if the allele frequ known., 9551:At a given point of tir given bi-allelic gene, the su allele frequencies would be 9552:At a given point of tir total of all genotypic freque to 1., | DU_J19_MSC_BOT_Q44 | |
| 46 | In the fine mapping of rII locus, Benzer was able to demonstrate intragenic recombination in phages mainly because | 9553:intragenic recombina only in phages., 9554: of the large number c progeny that could be scre 9555:making crosses in ph 9556:phages have haploid | DU_J19_MSC_BOT_Q45 | |
| 47 | In Lymnaea peregra, coiling behaviour is controlled by a single gene. Dextral coiling behaviour is governed by dominant allele 'D' and sinistral coiling by recessive allele 'd'. When a cross is made using sinistral as female and dextral as male, all the snails are sinistral in F1 and dextral in F2. Again in F3 a ratio of 3 dextral and 1 | 9557: Mendelian inheritance 9558:Cytoplasmic materna 9559:Cytoplasmic materna 9560:Epistasis | DU_J19_MSC_BOT_Q46 | |
| 48 | Study the following pedigree. What can be the possible inheritance pattern? | 9561:X-linked inheritance 9562:Y-linked inheritance, 9563: Mitochondrial inherita 9564:Autosomal inheritanc | DU_J19_MSC_BOT_Q47 | |
| 49 | Which of the following is not true about the classic experiment carried out to study the nature of mutations by the 1969 Nobel prize-winning team of Max Luria and Salvador Delbruck? | 9565:It is also called as Flu 9566:It demonstrated that mutations arise in the abse selection, and not as a resp selection., 9567:They inoculated equa of E. coli into separate cult with and without T1 phage. 9568:Equal number of T1 p resistant colonies were obt the plates. | DU_J19_MSC_BOT_Q48 | |
| 50 | A plant heterozygous for two tightly linked genes A and B, has the genotype AB/ab. Which of the following statements is truewhen the plant is self-pollinated? | 9569:The percentage of all types of gametes (AB, ab, be equal., 9570:Gametes with genoty will be less than those with 9571:Both loci will segrega ratio., 9572:The segregation ratic genes will depend upon the between them., | DU_J19_MSC_BOT_Q49 | |
| 51 | Mark the correct pairing of scientists and their contributions I Nirenberg and Matthei 1 Telomerase II Sidney Altman and Thomas Cech 2 DNA Polymerase I III Arthur Kornberg 3 Ribozyme IV Elizabeth | 9573:I-2; II-1; III-4; IV-3 9574:I-4; II-3; III-1; IV-2 9575:1-4; II-3; III-2; IV-1 9576:1-3; II-4; III-2; IV-1 | DU_J19_MSC_BOT_Q50 | |
| 52 | The factor responsible for mediating binding of core RNA polymerase to promoter is | 9577:a-70 9578:s-70 9579:?-55 9580:8-70 | DU_J19_MSC_BOT_Q51 | |
| 53 | Which of the following enzyme is involved in tRNA synthesis? | 9581: RNA Polymerase I 9582: RNA polymerase II 9583: RNA Polymerase III 9584: RNA polymerase IV | DU_J19_MSC_BOT_Q52 | |
| 54 | The study of man-made areas with complex dynamic ecological systems, influenced by interconnected biological, physical and social components is called as | 9585: System Ecology., 9586: Ecosystem Ecology 9587: Urban Ecology., 9588: Social Ecology., | DU_J19_MSC_BOT_Q53 | |
| 55 | Which of the following horizons in the soil profile has high amount of organic matter? | 9589: ? 9590: ? 9591: ? 9592: C | DU_J19_MSC_BOT_Q54 | |
| 56 | Hyperthermophiles are heat loving microbes that can live in temperature optima above | 9593:80 °C 9594:50 °C 9595:60 °C 9596:40 °C | DU_J19_MSC_BOT_Q55 | |
| 57 | A distribution in which individuals within a population have an equal chance of living anywhere within an area is called as | 9597:Random. 9598:Regular. 9599:Clumped. 9600:Contiguous | DU_J19_MSC_BOT_Q56 | |
| 58 | Which of the following chemical substances are secreted by some animals for communication with other members of their species? | 9601:Alkaloids 9602:Phenols 9603:Terpenoids 9604:Pheromones | DU_J19_MSC_BOT_Q57 | |
| 59 | The probability of death of organisms with different ages in the current year is shown in | 9605:Survivorship curve 9606: Static life table 9607:Cohort life table 9608: Natality | DU_J19_MSC_BOT_Q58 | |
| 60 | The Shannon-Weiner index measures: | 9609: Dominance 9610: General diversity 9611: Evenness 9612: Similarity-dissimilari | DU_J19_MSC_BOT_Q59 | |
| 61 | Which of the following statements on filiform apparatus is not correct? | 9613:It is a highly convolut of the micropylar portion of wall. 9614:It increases the surfa plasma membrane of syner 9615:It controls pollen tub 9616:It determines the pol egg apparatus. | DU_J19_MSC_BOT_Q60 | |
| 62 | Hypostase refers to | 9617:a cap-like structure c cells above the embryo sac 9618:a group of cells belov sac and above the funiculu: 9619:nucellar cells above t sac., 9620:parietal cells., | DU_J19_MSC_BOT_Q61 | |
| 63 | The members of which of the following angiosperm families do not form endosperm? | 9621:Poaceae 9622:Podostemaceae 9623: Brassicaceae 9624:Papilionaceae | DU_J19_MSC_BOT_Q62 | |
| 64 | Which of the following parts is not observed in a mature seed-coat? | 9625:Epidermis 9626:Aerenchyma 9627:Hypodermis 9628:Aril | DU_J19_MSC_BOT_Q63 | |
| 65 | Which one of the following statements is not true for aposporous embryo sac development? | 9629: The first and second divisions result in a tetrad c megaspores. 9630:Three megaspores de while functional haploid me undergoes megagametoge 9631:All the four megaspo degenerate while an aposp forms the embryo sac., 9632: Tetrad is surrounded wall., | DU_J19_MSC_BOT_Q64 | |
| 66 | Polysporangiate anthers are seen in the family | 9633:Amborellaceae., 9634:Anacardiaceae 9635:Annonaceae. 9636:Agavaceae. | DU_J19_MSC_BOT_Q65 | |
| 67 | In a pollen wall, the following enzymes serve as markers for intine and exine, respectively. | 9637:Acid phosphatases ar 9638: Pectinases and catala 9639: Lipases and cutinases 9640:Kinases and ß-1,3 glu | DU_J19_MSC_BOT_Q66 | |
| 68 | Buzz pollination is associated with flowers wherein the anthers exhibit | 9641:longitudinal dehiscen 9642:valvular dehiscence. 9643:poricidal dehiscence. 9644:explosive dehiscence | DU_J19_MSC_BOT_Q67 | |
| 69 | Fluorochromatic reaction test to ascertain pollen viability was developed by | 9645:P. Maheshwari. 9646:E. Strasburger., 9647:J. Heslop-Harrison. 9648:S.G. Nawaschin. | DU_J19_MSC_BOT_Q68 | |
| 70 | Which of the following statements is not correct about aquaporins? | 9649:Aquaporins are founc and animal cell membranes 9650:Phosphorylation and concentration regulates aqi activity., 9651:Activity of aquaporin by pH and reactive oxygen 9652:Aquaporins cannot tr uncharged molecules like M | DU_J19_MSC_BOT_Q69 | |
| 71 | The water potential of pure water at atmospheric pressure is | 9653:-2.3 bar., 9654:+2.3 bar., 9655:0 bar., 9656:1 bar., | DU_J19_MSC_BOT_Q70 | |
| 72 | In root nodules of legumes, leg-haemoglobin is important because it | 9657:transports oxygen to nodule., 9658:acts as an oxygen sc 9659:provides energy to th fixing bacterium., 9660:acts as a catalyst in transamination., | DU_J19_MSC_BOT_Q71 | |
| 73 | Pfr shows maximum absorption at | 9661:730 nm., 9662:660 nm., 9663:466 nm., 9664:650 nm., | DU_J19_MSC_BOT_Q72 | |
| 74 | In non-graminaceous plant roots, iron is transported across the plasma membrane as | 9665: Both ferrous and ferr 9666:Fe-Chelate 9667:Ferrous ions, 9668: Ferric ions | DU_J19_MSC_BOT_Q73 | |
| 75 | Methionine is the precursor of which of the following plant growth regulators? | 9669:Abscisic acid 9670:Indole acetic acid 9671:Cytokinins 9672:Ethylene | DU_J19_MSC_BOT_Q74 | |
| 76 | PEP carboxylase activity in C4 and CAM plants is regulated by | 9673:phosphorylation-deph 9674:oxidation-reduction 9675:carboxylation-decarb 9676:isomerization | DU_J19_MSC_BOT_Q75 | |
| 77 | One molecule of Calmodulin, a calcium binding protein in eukaryotic cells binds to Ca2+ ions. | 9677:4 9678:2 9679:8 9680:14 | DU_J19_MSC_BOT_Q76 | |
| 78 | Anabolic component of the carbohydrate metabolism includes which one of the following processes? | 9681:Glycogenolysis 9682:Citric Acid Cycle 9683:Glyconeogenesis 9684:Uronic Acid Pathways | DU_J19_MSC_BOT_Q77 | |
| 79 | High activity of sucrose synthase is present in | 9685:tissues that synthesiz 9686: tissues that utilize su 9687:photosynthetic leaves 9688:sucrose exporting tiss | DU_J19_MSC_BOT_Q78 | |
| 80 | Which one of the following is considered to be a signal metabolite that regulates the partitioning between sucrose and starch synthesis? | 9689:Fructose-2, 6-bisphos 9690:Fructose-1, 6-bisphos 9691:Fructose 6-phosphate 9692:Fructose 2-phosphate | DU_J19_MSC_BOT_Q79 | |
| 81 | Two different DNA molecules were isolated from a bacterial sample. Further experiments demonstrated thatdemonstrated that one of these (X) was composed of 40%A, 40%G, 10%T and 10%C but could not be cut by an exonuclease. The second DNA sample (Y) could be cut by the exonuclease and was found to be composed of 30%A, 30%T, 20%G and 20%C. Which one of the following statements can be correctly deduced from the above? | 9693:DNA X has a double-- linear structure 9694:DNA Y has a double-s circular structure 9695:DNA X has a single-s linear structure 9696:DNA X has a single-s circular structure | DU_J19_MSC_BOT_Q80 | |
| 82 | The 5' - 3' nucleotide sequence of one of the strands of a double stranded DNA molecule is given below: 5' – ATGACGATGGACACATGACATAGACGATAATGCCGTGAC - 3' In the absence of Tm effects, which one of the following sets of primers could, theoretically, be used to amplify the target sequence by PCR? | 9697: 5'- ATGACGA – 3' a GTCACGG - 3' 9698: 5'- TACTGCT – 3' a GGCACTG-3' 9699: 5'- TCGTCAT – 3' a CCGTGAC – 3' 9700: 5'- ATGACGA – 3' a CCGTGAC – 3' | DU_J19_MSC_BOT_Q81 | |
| 83 | In plant tissue culture, a high cytokinin: auxin ratio promotes the formation of | 9701:roots. 9702:callus. 9703:embryos. 9704:shoots. | DU_J19_MSC_BOT_Q82 | |
| 84 | Which one of the following genes does not confer resistance to a herbicide? | 9705:EPSPS 9706:pat 9707:ALS 9708:nptII | DU_J19_MSC_BOT_Q83 | |
| 85 | Which one of the following statements about cDNA libraries is not correct? | 9709:They are generally co larger fragments as compa genomic DNA libraries 9710:They can be used to alternatively spliced forms 9711:They can be used to quantitative variations in go expressions levels between tissues 9712:They can be used to variations in gene expressi between different developm of a plant | DU_J19_MSC_BOT_Q84 | |
| 86 | Which one of the following crops was the first to have its nuclear genome sequenced? | 9713:Maize 9714: Wheat 9715: Rice 9716: Barley | DU_J19_MSC_BOT_Q85 | |
| 87 | The term "Bio-pharming" refers to | 9717:genetically modified f plants. 9718:synthesis of drugs fro plants/animals. 9719:recombinant drugs fr 9720:large scale farming o plants. | DU_J19_MSC_BOT_Q86 | |
| 88 | Which of the following is the regulatory body conferring approval for transgenic plants? | 9721:NBPGR 9722:NBA 9723:GEAC 9724:NBRI | DU_J19_MSC_BOT_Q87 | |
| 89 | Identify the incorrect combination from the following: | 9725:Protoplast – E.C. Cock 9726:Edible vaccine - C.J. 9727:Somaclonal variation Steward 9728:GUS reporter system Jefferson | DU_J19_MSC_BOT_Q88 | |
| 90 | Similarity resulting from common ancestry is called | 9729:homoplasy 9730:homology 9731:homonym 9732:convergence | DU_J19_MSC_BOT_Q89 | |
| 91 | Which one of the following is the most primitive basal angiosperm? | 9733:Amborella 9734:Nymphaea 9735:Magnolia 9736:Hibiscus | DU_J19_MSC_BOT_Q90 | |
| 92 | In species where pollen matures and is released prior to the maturation and receptivity of the gynoecium, the condition is called | 9737:protogyny 9738:protoandry 9739:dichogamy 9740:androdioecy | DU_J19_MSC_BOT_Q91 | |
| 93 | Which one of the following statements is not correct? | 9741:All taxonomic keys ar dichotomous. | DU_J19_MSC_BOT_Q92 | |
| 94 | Glucosinolates do not occur in | 9742: Capparidaceae | DU_J19_MSC_BOT_Q93 | |
| 95 | Consider the following statements: A. The species are considered as basic units in taxonomy. B. In a cladogram, the branch length is proportional to the extent of evolutionary change. C. Polyphasic taxonomy is based on phenetic characters alone. Which of the statements is/are correct? | 9743: A and B 9744: B and C 9745: A and C 9746: A only | DU_J19_MSC_BOT_Q94 | |
| 96 | The latest system of classification which takes into account the phylogenetic relationship and gives weightage to the molecular data is | 9747: Bentham and Hooker system 9748: Engler and Prantl system 9749: Takhtajan system 9750: APG system | DU_J19_MSC_BOT_Q95 | |
| 97 | Which of the following statements on 'molecular clock' is correct? | 9751: The rate of molecular evolution varies with the proteins. 9752: Calibration of molecular clock is not possible 9753: Molecular clock runs fastest in primates 9754: Generation time has no role in the rate of evolution of genes. | DU_J19_MSC_BOT_Q96 | |
| 98 | Which of the following can be used as the most suitable 'outgroup' for assessing the phylogeny of flowering plants? | 9755: Lycophytes 9756: Gnetophytes 9757: Ferns 9758: Gymnosperms | DU_J19_MSC_BOT_Q97 | |
| 99 | Which one of the following genes/gene families have played a major role in specifying floral development? | 9759: MADS-box genes 9760: Heat shock protein genes 9761: Transcription factor genes 9762: Ribosomal protein genes | DU_J19_MSC_BOT_Q98 | |
| 100 | According to the principle of priority, the correct name of a taxon is the one which | 9763: has the widest usage 9764: is most appropriate 9765: was first published with proper description 9766: is most familiar. | DU_J19_MSC_BOT_Q99 |
Visit FirstRanker.com for more information.
--- Content provided by FirstRanker.com ---
This download link is referred from the post: DUET Last 10 Years 2011-2021 Question Papers With Answer Key || Delhi University Entrance Test conducted by the NTA